Code Challenges

Learning a new language always implies solving problems, in this post I will put two exercises that might help you to test your skills on any language, in my case I solved them to be more confident programming in rust. I searched for problems with practical applications to make them more interesting.

Intersection Over Union (IoU)

This one is used in object detection, Let A and B being two rectangles described by their up left and down right corners.

• For example let A and B be:

    A = {up_left: {x: 0, y: 0}, down_right: {x: 5, y: 5}}
    B = {up_left: {x: 2, y: 3}, down_right: {x: 4, y: 4}}

xy axis are configured in the following way:

+---------------->(x)
| . . . . . . . .
| . . . . . . . .
| . . . . . . . .
| . . . . . . . .
| . . . . . . . .
| . . . . . . . .
| . . . . . . . .
v
(y)

Given any A an B return the Intersection over union between both rectangles

DNA Sequencing

The DNA Sequence is composed of a series of nucleotides abbreviated as ‘A’, ‘C’, ‘G’ and ‘T’.

• For example “ACGAATTCCG” is a DNA sequence

Given a string s: that represents a DNA sequence, return all 10-letter-long sequences (substrings) that occur more than once in a DNA molecule. You may return the answer in any order.

Example 1:

Input: s = "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT"
Output: ["AAAAACCCCC","CCCCCAAAAA"]

Example 2:

Input: s = "AAAAAAAAAAAAA"
Output: ["AAAAAAAAAA"]